Ang (NM_007447) Mouse Untagged Clone

CAT#: MC205895

Ang (untagged) - Mouse angiogenin, ribonuclease, RNase A family, 5 (Ang), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ang
• Synonyms: AI385586; Ang1; Rnase5; Rnase5a
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC055355
  CCTGTCTCCAGGAGCACGCAGCTAGACACATTCCCAGTCGGAGGAAAGCTGGCCAGCTTTGGAATCTCTG TTGGAAGAGATGGCGATAAGCCCAGGCCCGTTGTTCTTGATCTTCGTGCTGGGTCTGGTTGTGATCCCTC CCACTCTGGCTCAGGATGACTCCAGGTACACAAAATTCCTGACTCAGCACCATGACGCCAAGCCAAAGGG CCGGGACGACAGATACTGTGAACGTATGATGAAGAGAAGAAGCCTAACCTCACCCTGCAAAGATGTCAAC ACCTTTATCCATGGCAACAAGAGCAACATCAAGGCCATCTGTGGAGCGAATGGAAGCCCTTACAGAGAAA ACTTAAGAATGAGCAAGTCTCCCTTCCAGGTCACCACTTGCAAGCACACAGGAGGGTCTCCCCGGCCTCC ATGCCAGTACCGAGCCTCTGCAGGGTTCAGACATGTTGTTATTGCCTGTGAGAATGGCTTGCCGGTCCAC TTCGATGAGTCATTTTTCAGTCTATAGTCAGCAGGCCCCTGGCACAGACCTAGCTATGTTTTCTTTTTAT CTCCCCTCATAGCCCAGAACACTGGTTCCAGCGTTCATTGTCAGGGGCCAGAAAAACGAACTATCTAAAA CATATGTCTCCTGATTTGCAATGCACAGAAATAAAGATGTCTCAAAAGCCAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_007447
• ORF Size: 438 bp
• Insert Size: 438
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC055355, AAH55355
• RefSeq Size: 695
• RefSeq ORF: 438
• Locus ID: 11727
• Gene Summary: This gene encodes a member of the pancreatic ribonuclease A superfamily and is a potent inducer of neovascularization. The encoded protein is a secreted multifunctional tRNA-specific ribonuclease that promotes angiogenesis in response to angiogenetic stimuli such as hypoxia, mediates stress-induced translational repression by cleaving cellular tRNAs, stimulates cell proliferation by mediating rRNA transcription in prostate cancer cells, and is involved in neurite pathfinding. This gene resides in a cluster of highly related genes. It shares dual promoters and 5' exons with the ribonuclease, RNase A family 4 gene. Two alternatively spliced variants, with different 5' exons but the same coding exon, have been identified. Multiple pseudogenes have been found for this gene. [provided by RefSeq, Jun 2009]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.