H2afz (BC079903) Mouse Untagged Clone

CAT#: MC206213

H2afz (untagged) - Mouse H2A histone family, member Z (cDNA clone MGC:96771 IMAGE:30622912), (10ug)


  "BC079903" in other vectors (1)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "H2afz"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol H2afz
Synonyms H2A.Z
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC079903
GGCGCGAGGAAGGCGGGAGACGGCGCAGTTTGAATCGCGGTCCGACGGAGGAGTGGGCGCTGGGATCTCG CTGAGCGTCCGCCTGGCCTCGTCTCTTCCTCGCTCGTCGGAGCTTCAGCACGGTCCGAGATGGCTGGCGG TAAGGCTGGAAAGGACTCCGGAAAGGCCAAGACAAAGGCGGTTTCCCGCTCGCAGCGAGCCGGCTTGCAG TTCCCTGTGGGCCGTATTCATCGACACCTGAAATCTAGGACAACCAGCCACGGACGTGTGGGCGCGACCG CCGCTGTGTACAGCGCAGCCATCCTGGAGTACCTCACCGCAGAGGTACTTGAGTTGGCAGGAAATGCGTC AAAAGACTTAAAGGTAAAGCGTATCACCCCTCGTCACTTGCAGCTTGCTATACGTGGAGATGAAGAATTG GATTCTCTGATCAAAGCTACCATTGCTGGTGGTGGTGTCATCCCACACATCCACAAATCGCTGATCGGGA AGAAAGGACAACAGAAGACTGTTTAAGGATGCCTGGATTCCTTATTATCTCAGGACTCTAAATATTCCTA ACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTTTTGTAA TTCTATTTGAGCAAGTTGGAGGCTTAATTAGCCTTCCAACCAACCAAATTTCTGCATTCGAGTCTTAACC ATATTTAAGTGTTACTGTGGCTTCAAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTGAGTTGACT GTTTTTAAAAAACTGTTTGGATTTTAATTGTGATGCAGAAGTTATAGTAACAAGCATTTGGTTTTGTACA GACATTGTTTCCACTCTGGTGGATAAGCTCAATAAAGGTCATATCCCAAACTAAAAAAAAAAAAAAAAAA AA
Restriction Sites AscI-NotI     
ACCN BC079903
ORF Size 387 bp
Insert Size 387
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC079903, AAH79903
RefSeq Size 912
RefSeq ORF 387
Locus ID 51788
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.