Fabp2 (BC013457) Mouse Untagged Clone

CAT#: MC206794

Fabp2 (untagged) - Mouse fatty acid binding protein 2, intestinal (cDNA clone MGC:18570 IMAGE:4218050), (10ug)


  "BC013457" in other vectors (1)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Fabp2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fabp2
Synonyms I-FABP
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC013457
GAGACACACACAGCTGAGATCATGGCATTCGACGGCACGTGGAAAGTAGACCGGAACGAGAACTATGAAA AGTTCATGGAGAAAATGGGCATTAATGTGATGAAGAGGAAGCTTGGAGCTCATGACAATCTGAAACTGAC AATCACACAGGATGGAAATAAATTCACAGTCAAAGAATCAAGCAACTTCAGAAACATTGATGTTGTGTTT GAGCTCGGTGTAAACTTTCCCTACAGTCTAGCAGACGGAACGGAGCTCACTGGGGCCTGGACCATTGAGG GAAATAAACTTATTGGGAAATTCACACGTGTAGACAATGGAAAGGAGCTGATTGCTGTCCGAGAGGTTTC TGGTAATGAACTAATCCAGACCTACACATATGAAGGAGTTGAGGCCAAGCGATTCTTTAAGAAGGAATAA GTCAACTTCTCAGAGCCTGGAGCAACGCTGAAGAGCTAAGCTGATGTCAGATTTCTTTCTCCATCATGCT AATGCCAGGCTCATTCGTCATCCTATCAGCACTGGTCTCCAGCCTTGTCAAAGCTAAAGAAGTAAAAGCT AATTAAAAGAACTTCATTTGTTTTATGATCCTTAAGCTATACATGAACTAGTCTTTTAAAAGAAAATAAA TCCTGTTCTCACACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAA
Restriction Sites EcoRI-NotI     
ACCN BC013457
ORF Size 399 bp
Insert Size 399
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC013457, AAH13457
RefSeq Size 774
RefSeq ORF 399
Locus ID 14079
Gene Summary The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. This protein functions within enterocytes, possibly to sense lipids as part of energy homeostasis. In humans polymorphisms are associated with increased fat oxidation and insulin resistance. In mice deficiency of this gene alters body weight in a gender-specific manner and causes hyperinsulinemia. [provided by RefSeq, Jan 2013]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.