Cck (BC028487) Mouse Untagged Clone

CAT#: MC206823

Cck (untagged) - Mouse cholecystokinin (cDNA clone MGC:41001 IMAGE:1400830), (10ug)


  "BC028487" in other vectors (4)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cck
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028487
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAGCGGCGTATGTCTGTGCGTGGTGATGGCAGTCCTAGCTGCTGGCGCCCTGGCGCAGCCGGTAG
TCCCTGCAGAAGCTACGGACCCCGTGGAGCAGCGGGCGCAAGAGGCGCCCCGAAGGCAGCTGCGGGCTGT
GCTCCGGACGGACGGCGAGCCCCGAGCGCGCCTGGGCGCACTGCTAGCGCGATACATCCAGCAGGTCCGC
AAAGTGGCATGGATGGTGACCTCTGGTTGGGTGTTAACCTGGACCAGTAGAGCTGGATTAAAACACAGGA
GGTGGGCATCCTTTCTGTGGAGCTCACGAACCCAATTTTTCCTGCCCGCATTTGAACAGCCCATGGCTTG
TCGACCTGTCTGCATTTGGCTTGACTGCTCCTTCTGGCCGCATGTCCGTTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC028487
ORF Size 405 bp
Insert Size 405
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC028487, AAH28487
RefSeq Size 816
RefSeq ORF 404
Locus ID 12424
Gene Summary This gene encodes a member of the gastrin/cholecystokinin family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the peptide hormones cholecystokinin-8, -12, -33, and others. The encoded peptides have been shown to regulate gastric acid secretion and food intake. A sulfated form of cholecystokinin-8 may modulate neuronal activity in the brain. Homozygous knockout mice for this gene exhibit impaired insulin secretion, enhanced insulin sensitivity, and resistance to obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.