Crem (BC034856) Mouse Untagged Clone
CAT#: MC206826
Crem (untagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396), (10ug)
"BC034856" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Crem |
Synonyms | ICER|ICERI |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC034856
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCATGGAAACAGTTGAATCACAGCAGGATCGAAGTGTAACACGTTCTGTGGCAGAGCATAGCTCTG CTCATATGCAGACTGGTCAAATTTCTGTTCCTACTCTAGCTCAGGTAGCAACAATTGCAGAGACAGATGA TTCTGCAGACTCAGAAGTAATTGATTCGCATAAACGTAGAGAAATTCTTTCACGAAGACCCTCATATAGA AAAATACTGAATGAACTTTCCTCTGATGTGCCTGGTATTCCCAAGATTGAAGAAGAAAAATCAGAGGAAG AAGGGACACCACCTAACATTGCTACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATA CAGTATGTATGCTATGATTCCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC034856 |
ORF Size | 375 bp |
Insert Size | 375 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Reference Data | |
RefSeq | BC034856, AAH34856 |
RefSeq Size | 941 |
RefSeq ORF | 374 |
Locus ID | 12916 |
Gene Summary | This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200636 | Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 420.00 |
|
MG200636 | Crem (GFP-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 460.00 |
|
MR200636L1 | Lenti ORF clone of Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 620.00 |
|
MR200636L2 | Lenti ORF clone of Crem (mGFP-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 768.00 |
|
MR200636L3 | Lenti ORF clone of Crem (Myc-DDK-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 620.00 |
|
MR200636L4 | Lenti ORF clone of Crem (mGFP-tagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review