Crem (BC034856) Mouse Untagged Clone

CAT#: MC206826

Crem (untagged) - Mouse cAMP responsive element modulator (cDNA clone MGC:41125 IMAGE:3373396), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Crem
• Synonyms: ICER|ICERI
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC034856
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACCATGGAAACAGTTGAATCACAGCAGGATCGAAGTGTAACACGTTCTGTGGCAGAGCATAGCTCTG
  CTCATATGCAGACTGGTCAAATTTCTGTTCCTACTCTAGCTCAGGTAGCAACAATTGCAGAGACAGATGA
  TTCTGCAGACTCAGAAGTAATTGATTCGCATAAACGTAGAGAAATTCTTTCACGAAGACCCTCATATAGA
  AAAATACTGAATGAACTTTCCTCTGATGTGCCTGGTATTCCCAAGATTGAAGAAGAAAAATCAGAGGAAG
  AAGGGACACCACCTAACATTGCTACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATA
  CAGTATGTATGCTATGATTCCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC034856
• ORF Size: 375 bp
• Insert Size: 375
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC034856, AAH34856
• RefSeq Size: 941
• RefSeq ORF: 374
• Locus ID: 12916
• Gene Summary: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]