Ltc4s (BC028760) Mouse Untagged Clone

CAT#: MC206837

Ltc4s (untagged) - Mouse leukotriene C4 synthase (cDNA clone MGC:41203 IMAGE:1348372), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ltc4s
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206837 representing BC028760
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGACGAAGTGGCTCTTCTGGCTACCGTCACCCTCGTGGGAGTTCTGTTGCAAGCCTACTTCTCCC
  TACAGGTGATCTCTGCACGAAGGGCTTTCCACGTGTCGCCGCCGCTCACCTCTGGCCCTCCCGAGTTCGA
  GCGCGTCTTCCGAGCCCAGGTAAACTGCAGCGAGTACTTTCCGCTGTTCCTCGCCACACTCTGGGTCGCC
  GGCATCTTCTTCCACGAAGGAGCCGCAGCCCTGTGCGGACTGTTCTACCTGTTCGCGCGCCTCCGCTATT
  TCCAGGGATACGCGCGCTCAGCGCAACTCAGATGGCTCCAGATGCTCCTGCCGATGGCCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC028760
• ORF Size: 342 bp
• Insert Size: 342
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC028760, AAH28760
• RefSeq Size: 503
• RefSeq ORF: 341
• Locus ID: 17001
• Gene Summary: The protein encoded by this gene is an enzyme that catalyzes the synthesis of leukotriene C4 by combining leukotriene A4 with reduced glutathione. The encoded protein is found in the outer nuclear membrane and in the peripheral endoplasmic reticulum. Leukotrienes have been implicated as mediators of anaphylaxis and inflammatory conditions such as bronchial asthma in humans. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]