Hebp2 (BC006898) Mouse Untagged Clone

CAT#: MC206878

Hebp2 (untagged) - Mouse heme binding protein 2 (cDNA clone MGC:11934 IMAGE:3599858), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hebp2
• Synonyms: SOUL
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC006898
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCAGAGGAGCCGGAGCCAGATCTCGGGGTGGCCGAGGGCTCAGAGGATCAGGCCTTGGAGATGCCGA
  GCTGGAAAGCTCCGGAGGACATAGACCCCCAGCCAGGAAGTTATGAGATCCGGCACTACGGACCGGCTAA
  GTGGGTCAGCACTTGCGTGGAGTCCCTGGACTGGGATTCAGCCATCCAGACTGGTTTCACAAAATTGAAT
  GGCTACATTCAAGGCAAAAATGAGAAAGAGATGAAAATCAAGCTGACAGCCCCGGTGACAAGCTACGTGG
  AGCCCGGCTCAAGTCCTTTCAGTCTTTTGATGGATTCTCCAGTGGCCAAAAGAATCAAGAACAACTTTTG
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC006898
• ORF Size: 351 bp
• Insert Size: 351
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: BC006898, AAH06898
• RefSeq Size: 986
• RefSeq ORF: 350
• Locus ID: 56016