Cflar (BC023121) Mouse Untagged Clone

CAT#: MC207022

Cflar (untagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cflar
• Synonyms: MRIT, CLARP, FLAME, Casper, I-FLICE, Flip
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC023121, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATG
  GTGGCTCACAACCATCTGTAACAAGATCTGACTCCCTCTTCTGGAGTGTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: BC023121
• ORF Size: 2015 bp
• Insert Size: 2015
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC023121
• RefSeq Size: 2019
• RefSeq ORF: 2015
• Locus ID: 12633