Cflar (BC023121) Mouse Untagged Clone
CAT#: MC207022
Cflar (untagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551), (10ug)
"BC023121" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Symbol | Cflar |
| Synonyms | MRIT, CLARP, FLAME, Casper, I-FLICE, Flip |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for BC023121, the custom clone sequence may differ by one or more nucleotides
ATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATG GTGGCTCACAACCATCTGTAACAAGATCTGACTCCCTCTTCTGGAGTGTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC023121 |
| ORF Size | 2015 bp |
| Insert Size | 2015 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | BC023121 |
| RefSeq Size | 2019 |
| RefSeq ORF | 2015 |
| Locus ID | 12633 |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR200009 | Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
USD 68.00 |
|
| MG200009 | Cflar (GFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
USD 300.00 |
|
| MR200009L3 | Lenti ORF clone of Cflar (Myc-DDK-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
USD 500.00 |
|
| MR200009L4 | Lenti ORF clone of Cflar (mGFP-tagged) - Mouse CASP8 and FADD-like apoptosis regulator (cDNA clone MGC:28609 IMAGE:4218551) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China