Arf1 (NM_007476) Mouse Untagged Clone

CAT#: MC207033

Arf1 (untagged) - Mouse ADP-ribosylation factor 1 (Arf1), transcript variant 2, (10ug)


  "NM_007476" in other vectors (6)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Arf1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Arf1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207033 representing NM_007476
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAATATCTTTGCAAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATTCTCATGGTGG
GCCTGGATGCTGCAGGGAAGACAACAATTCTATACAAACTTAAGCTGGGCGAAATTGTGACCACCATTCC
CACCATTGGTTTCAATGTGGAGACTGTTGAATACAAGAATATCAGCTTCACCGTGTGGGATGTGGGCGGC
CAGGACAAGATCCGGCCGCTGTGGCGCCACTACTTCCAGAACACCCAAGGCTTGATCTTCGTAGTGGACA
GCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAAGAGCTCATGAGGATGCTAGCTGAAGATGAGCTCCG
AGATGCTGTTCTCTTGGTGTTTGCCAACAAGCAGGACCTCCCCAATGCCATGAATGCGGCCGAAATCACA
GACAAGCTGGGGCTGCACTCTCTACGCCACAGGAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGG
ACGGGCTCTATGAAGGACTAGATTGGCTGTCTAATCAGCTCCGGAACCAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007476
ORF Size 546 bp
Insert Size 546
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_007476.3, NP_031502.1
RefSeq Size 1799
RefSeq ORF 546
Locus ID 11840
Gene Summary GTP-binding protein that functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. Involved in protein trafficking among different compartments. Modulates vesicle budding and uncoating within the Golgi complex. Deactivation induces the redistribution of the entire Golgi complex to the endoplasmic reticulum, suggesting a crucial role in protein trafficking. In its GTP-bound form, its triggers the association with coat proteins with the Golgi membrane. The hydrolysis of ARF1-bound GTP, which is mediated by ARFGAPs proteins, is required for dissociation of coat proteins from Golgi membranes and vesicles. The GTP-bound form interacts with PICK1 to limit PICK1-mediated inhibition of Arp2/3 complex activity; the function is linked to AMPA receptor (AMPAR) trafficking, regulation of synaptic plasicity of excitatory synapses and spine shrinkage during long-term depression (LTD). [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.