Tmigd3 (NM_001174169) Mouse Untagged Clone

CAT#: MC207048

Adora3 (untagged) - Mouse adenosine A3 receptor (Adora3), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tmigd3
• Synonyms: 1700001d09rik; 4930578J19Rik; Tg(H2-K-CALR*)del52Shmd
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207048 representing NM_001174169
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTTGGCTGGAATAGAAAAGCAACCTTAGCGAGCTCTCAAAATAGCAGCACTCTTTTGTGCCACTTCC
  GTTCCGTGGTCAGTTTGGATTACATGGTCTTCTTCAGCTTCGTCACCTGGATCCTCGTCCCCCTGGTTGT
  CATGTGTGTCATCTACCTAGACATCTTCTACATCATCCGAAATAAGCTCAGTCAAAACCTGTCTGGCTTC
  AGAGAGACGCGTGCATTTTATGGACGGGAGTTCAAGACAGCTAAGTCCCTGTTTCTGGTTCTCTTCTTGT
  TTGCGCTGTGCTGGCTGCCTTTGTCCATCATCAATTTTGTTTCCTATTTTGATGTAAAGATACCAGATGT
  CGCAATGTGCCTGGGGATCCTGTTGTCCCACGCGAACTCCATGATGAACCCTATTGTCTACGCCTGCAAA
  ATAAAAAAGTTCAAAGAGACCTACTTTCTGATCCTCAGAGCTCTCAGGCTCTGTCAGACCTCAGATTCTT
  TGGACTCAAACATGGAACAGACTACTGAGTAA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001174169
• ORF Size: 522 bp
• Insert Size: 522
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001174169.2, NP_001167640.1
• RefSeq Size: 1794
• RefSeq ORF: 522
• Locus ID: 69296
• Gene Summary: This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 3' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:11542). [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) includes the same 5' terminal exon but lacks the remaining exons and instead includes an alternate 3' terminal exon, compared to variant 2. The 3' terminal exon is shared with that of the adenosine A3 receptor gene. The encoded isoform (3), which is shorter and distinct compared to isoform 2, represents the C-terminal region of the adenosine A3 receptor. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.