Syce2 (NM_001168244) Mouse Untagged Clone

CAT#: MC207123

Syce2 (untagged) - Mouse synaptonemal complex central element protein 2 (Syce2), transcript variant 3, (10ug)


  "NM_001168244" in other vectors (3)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Syce2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Syce2
Synonyms 1700013H19Rik; AA407907; Cesc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207123 representing NM_001168244
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCAACTTCAGGGACAGCCTCAAGATGAAGGTCTCAGATCTGACAGAAAAGTTGGAGGAGAGGATGT
ACCAGGTGTACAGCCACCACAGCAAAATCATTCAGGAAAGACTACAAGAATTTACCCAGAAGATGGCAAA
GATCAACCATCTGGAAATGGAGCTTAAACAAGTCTGCCAAACTGTGGAAACGGTGTACAAGGACCTATGT
GTCCAGTCTGAGGTTCCCACTTGCGAAGAACAGAATTACAAAGATGGTGAATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001168244
ORF Size 267 bp
Insert Size 267
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001168244.1, NP_001161716.1
RefSeq Size 1230
RefSeq ORF 267
Locus ID 71846

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.