Ms4a6c (NM_001166376) Mouse Untagged Clone

CAT#: MC207133

Ms4a6c (untagged) - Mouse membrane-spanning 4-domains, subfamily A, member 6C (Ms4a6c), transcript variant 2, (10ug)


  "NM_001166376" in other vectors (3)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ms4a6c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ms4a6c
Synonyms 2200009H22Rik; 2210417N07Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207133 representing NM_001166376
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTCCACAGGTAGTGACCAATGAGACCATCACAACGATTTCACCAAATGGAATCAACTTTCCCCAAA
AAGACGAGTCCCAGCCTACCCAACAGAGGCAAGACAGCCTGAAGAAACATCTAAAGGCTGAGATCAAAGT
GATAGTGGCAATCCAGATCATGTGTGCTGTGACAGTGTTGGCTCTGGGAATCATTTTGGCATCTGTTCCT
CCTGTCCCATATTTTAACTCAGTGTTTTCTGTCCTGTTAAAATCTGGCTACCCATTTATAGGAGCTTTGT
TTGTAAGTAGACTTCTGGGGGGAATAAAATGGGGGAAGACAGAGAAGGGAGTTTTCACCCAGCTGCATTT
CTGTATACTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166376
ORF Size 363 bp
Insert Size 363
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001166376.1, NP_001159848.1
RefSeq Size 714
RefSeq ORF 363
Locus ID 73656
Gene Summary May be involved in signal transduction as a component of a multimeric receptor complex. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has multiple differences in the presence and absence of exons at its 3' end, compared to variant 1. These differences produce a unique 3' coding region and 3' UTR, compared to variant 1. The encoded protein (isoform 2) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.