Dynlrb2 (BC048623) Mouse Untagged Clone

CAT#: MC207144

Dynlrb2 (untagged) - Mouse dynein light chain roadblock-type 2 (cDNA clone MGC:58714 IMAGE:6743790), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Dynlrb2
• Synonyms: DNLC2B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC048623
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGACAGAAGTGGAGGAAACCCTCAAGAGAATCCAGAGTCACAAAGGGGTCATCGGAACGATGGTGGTCA
  ATGCAGAAGGCATTCCAATCCGAACAACCCTGGACAACTCCACAACGGTTCAGTATGCGGGTCTTCTCCA
  CCAGCTGACCATGAAAGCCAAGAGCACAGTCAGGGATATTGACCCCCAGAACGACCTGACTTTTCTTAGG
  ATCAGATCGAAGAAACATGAAATCATGGTAGCCCCAGAACCCATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: BC048623
• ORF Size: 258 bp
• Insert Size: 258
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: BC048623, AAH48623
• RefSeq Size: 559
• RefSeq ORF: 257
• Locus ID: 75465
• Gene Summary: Acts as one of several non-catalytic accessory components of the cytoplasmic dynein 1 complex that are thought to be involved in linking dynein to cargos and to adapter proteins that regulate dynein function. Cytoplasmic dynein 1 acts as a motor for the intracellular retrograde motility of vesicles and organelles along microtubules. [UniProtKB/Swiss-Prot Function]