BC006965 Mouse Untagged Clone

CAT#: MC207171

BC006965 (untagged) - Mouse cDNA sequence BC006965 (cDNA clone MGC:6956 IMAGE:3153901), (10ug)


  "BC006965" in other vectors (4)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BC006965"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol BC006965
Synonyms MGC6983, MGC6956
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC006965
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAAGGGACAGTGGAAAAATGGCAGGGCAGACCCCCTTGGATTTGCCCACGTGGAGTTTGGATATT
TACCTGGCTTCTTTGTCAAGTCTTGGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC006965
ORF Size 1323 bp
Insert Size 1323
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC006965
RefSeq Size 1413
RefSeq ORF 101
Locus ID 217294

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.