Ly6e (NM_008529) Mouse Untagged Clone

CAT#: MC207208

Ly6e (untagged) - Mouse lymphocyte antigen 6 complex, locus E (Ly6e), transcript variant 2, (10ug)


  "NM_008529" in other vectors (6)

Reconstitution Protocol

USD 340.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ly6e"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ly6e
Synonyms Ly67; RIG-E; Sca-2; TSA-1; Tsa1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207208 representing NM_008529
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGCCACTTCCAACATGAGAGTCTTCCTGCCTGTGCTGTTGGCAGCCCTTCTGGGCATGGAGCAAG
TTCATTCCCTGATGTGCTTCTCATGTACCGATCAGAAGAACAATATAAACTGCCTGTGGCCAGTTTCATG
CCAGGAGAAAGACCATTACTGTATCACGTTATCTGCCGCTGCGGGCTTTGGGAATGTCAACCTTGGCTAC
ACCCTGAACAAGGGCTGCTCCCCGATCTGCCCCAGTGAAAATGTCAATCTCAATCTCGGTGTGGCGTCCG
TGAACAGCTACTGCTGCCAAAGCTCCTTCTGCAACTTCAGCGCAGCTGGCCTCGGACTTCGTGCCAGTAT
CCCACTACTGGGCCTTGGACTCCTGCTTAGCTTGTTGGCTCTGCTGCAGCTGAGCCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008529
ORF Size 411 bp
Insert Size 411
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_008529.3, NP_032555.1
RefSeq Size 2278
RefSeq ORF 411
Locus ID 17069
Gene Summary Involved in T-cell development. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Variants 1 to 6 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.