Apoc3 (NM_023114) Mouse Untagged Clone

CAT#: MC207231

Apoc3 (untagged) - Mouse apolipoprotein C-III (Apoc3), (10ug)


  "NM_023114" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Apoc3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Apoc3
Synonyms apo-CIII; apoC-III
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207231 representing NM_023114
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCCCCGGACGCTCCTCACTGTGGCCCTCTTGGCTCTCCTGGCATCTGCCCGAGCTGAAGAGGTAG
AGGGATCCTTGCTGCTGGGCTCTGTGCAGGGCTACATGGAACAAGCCTCCAAGACGGTCCAGGATGCGCT
AAGTAGCGTGCAGGAGTCCGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCACTTCAGATTCCTG
AAAGGCTACTGGAGCAAGTTTACTGACAAGTTCACCGGCTTCTGGGATTCTAACCCTGAGGACCAACCAA
CTCCAGCTATTGAGTCGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_023114
ORF Size 300 bp
Insert Size 300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC021776, AAH21776
RefSeq Size 537
RefSeq ORF 300
Locus ID 11814
Gene Summary This gene encodes an apolipoprotein which is the major protein component of very-low-density lipoproteins (VLDL) and a minor component of high-density lipoproteins (HDL). The encoded protein is thought to regulate the metabolism of triglyceride-rich lipoproteins and play a role in lipid storage and the mobilization of fat cells. This gene is clustered with three other apolipoprotein genes on chromosome 9 and is associated with coronary disease. Mice lacking this gene have lower levels of total cholesterol in the plasma. Mutations in the human genes causes hyperalphalipoproteinemia 2, a disorder of lipid metabolism which results in a favorable lipid profile (lower LDL-cholesterol, higher HDL-cholesterol and lower levels of serum triglycerides when fasting and after a meal). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.