Fxyd2 (NM_007503) Mouse Untagged Clone

CAT#: MC207234

Fxyd2 (untagged) - Mouse FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Fxyd2
• Synonyms: Atp1g1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207234 representing NM_007503
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCTGGGGAAATATCAGATCTGTCAGCGAACAGTGGTGGCAGTGCCAAGGGGACAGAGAATCCCTTCG
  AGTACGACTATGAAACCGTCCGCAAAGGAGGCCTGATCTTCGCGGGCCTGGCCTTCGTCGTGGGCCTCCT
  CATCATTCTCAGCAAAAGGTTCCGCTGTGGGGGCGGTAAGAAACATAGGCAGGTCAATGAAGATGAACTG
  TGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_007503
• ORF Size: 213 bp
• Insert Size: 213
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_007503.3, NP_031529.2
• RefSeq Size: 569
• RefSeq ORF: 213
• Locus ID: 11936
• Gene Summary: This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The Type III integral membrane protein encoded by this gene is the gamma subunit of the Na,K-ATPase present on the plasma membrane. Although the Na,K-ATPase does not depend on the gamma subunit to be functional, it is thought that the gamma subunit modulates the enzyme's activity by inducing ion channel activity. Multiple transcript variants have been described for this gene that are expressed in tissue-specific and developmental stage-specific patterns and encode proteins that differ at the N-terminus. [provided by RefSeq, Sep 2009]
  Transcript Variant: This variant (a) represents the most frequently occurring transcript and it encodes the longest protein (isoform a).