Erh (NM_007951) Mouse Untagged Clone

CAT#: MC207267

Erh (untagged) - Mouse enhancer of rudimentary homolog (Drosophila) (Erh), (10ug)


  "NM_007951" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Erh
Synonyms Mer; Prei1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207267 representing NM_007951
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAGGGCAGGACTTATGCTGACTATGAGT
CTGTGAATGAGTGCATGGAAGGTGTTTGTAAAATGTATGAAGAACATCTGAAGAGGATGAATCCCAACAG
CCCTTCCATCACATACGATATCAGCCAGTTGTTTGATTTTATTGACGATCTGGCAGACCTCAGCTGTCTG
GTTTACCGAGCTGATACACAGACATACCAGCCGTATAACAAAGACTGGATCAAAGAGAAGATCTACGTGC
TCCTCCGTCGGCAGGCCCAACAGGCTGGGAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007951
ORF Size 315 bp
Insert Size 315
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007951.3, NP_031977.1
RefSeq Size 812
RefSeq ORF 315
Locus ID 13877
Gene Summary May have a role in the cell cycle. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.