Ntf3 (NM_008742) Mouse Untagged Clone

CAT#: MC207340

Ntf3 (untagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3, (10ug)


  "NM_008742" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ntf3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ntf3
Synonyms AI316846; AI835689; HDNF; NGF-2; Nt3; Ntf-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207340 representing NM_008742
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCATCTTGTTTTATGTGATATTTCTTGCTTATCTCCGTGGCATCCAAGGCAACAGCATGGATCAAA
GGAGTTTGCCGGAAGACTCTCTCAATTCCCTCATCATCAAGCTGATCCAGGCGGATATCTTGAAAAACAA
GCTTTCCAAACAGATGGTGGATGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCAGAGGCACCCAGG
GAACCAGAGCAGGGAGAGGCCACCAGGTCAGAGTTCCAGCCAATGATTGCAACGGACACAGAGCTACTAC
GGCAACAGAGACGCTACAATTCGCCCCGGGTCCTGCTGAGTGACAGCACCCCTTTGGAGCCCCCTCCCTT
ATACCTAATGGAGGATTATGTGGGCAACCCGGTGGTAGCCAATAGAACCTCACCACGGAGGAAACGCTAT
GCAGAACATAAGAGTCACCGAGGAGAGTACTCAGTGTGTGACAGTGAGAGCCTGTGGGTGACCGACAAGT
CCTCAGCCATTGACATTCGGGGACACCAGGTCACAGTGCTGGGGGAGATCAAAACCGGTAACTCTCCTGT
GAAACAATATTTTTATGAAACGAGATGTAAAGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGGATTGAT
GACAAACACTGGAACTCTCAGTGCAAAACTTCGCAAACCTATGTCCGAGCACTGACTTCAGAAAACAACA
AACTCGTAGGCTGGCGCTGGATACGAATAGACACTTCCTGTGTGTGTGCCTTGTCGAGAAAAATTGGAAG
AACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_008742
ORF Size 777 bp
Insert Size 777
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_008742.3, NP_032768.1
RefSeq Size 1342
RefSeq ORF 777
Locus ID 18205
Gene Summary This gene encodes a member of the neurotrophins that have a wide variety of functions in both neural and non-neural tissues. The encoded preproprotein undergoes proteolytic processing to generate a noncovalently linked homodimeric mature protein that can bind to the transmembrane receptor tyrosine kinases to initiate a series of signaling events. Mice lacking the encoded protein exhibit severe defects in the peripheral nervous system including a complete lack of spinal proprioceptive afferents and their peripheral sense organs. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (3) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.