Ntf3 (NM_008742) Mouse Untagged Clone

CAT#: MC207340

Ntf3 (untagged) - Mouse neurotrophin 3 (Ntf3), transcript variant 3, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ntf3
• Synonyms: AI316846; AI835689; HDNF; NGF-2; Nt3; Ntf-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207340 representing NM_008742
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCCATCTTGTTTTATGTGATATTTCTTGCTTATCTCCGTGGCATCCAAGGCAACAGCATGGATCAAA
  GGAGTTTGCCGGAAGACTCTCTCAATTCCCTCATCATCAAGCTGATCCAGGCGGATATCTTGAAAAACAA
  GCTTTCCAAACAGATGGTGGATGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCAGAGGCACCCAGG
  GAACCAGAGCAGGGAGAGGCCACCAGGTCAGAGTTCCAGCCAATGATTGCAACGGACACAGAGCTACTAC
  GGCAACAGAGACGCTACAATTCGCCCCGGGTCCTGCTGAGTGACAGCACCCCTTTGGAGCCCCCTCCCTT
  ATACCTAATGGAGGATTATGTGGGCAACCCGGTGGTAGCCAATAGAACCTCACCACGGAGGAAACGCTAT
  GCAGAACATAAGAGTCACCGAGGAGAGTACTCAGTGTGTGACAGTGAGAGCCTGTGGGTGACCGACAAGT
  CCTCAGCCATTGACATTCGGGGACACCAGGTCACAGTGCTGGGGGAGATCAAAACCGGTAACTCTCCTGT
  GAAACAATATTTTTATGAAACGAGATGTAAAGAAGCCAGGCCGGTCAAAAACGGTTGCAGGGGGATTGAT
  GACAAACACTGGAACTCTCAGTGCAAAACTTCGCAAACCTATGTCCGAGCACTGACTTCAGAAAACAACA
  AACTCGTAGGCTGGCGCTGGATACGAATAGACACTTCCTGTGTGTGTGCCTTGTCGAGAAAAATTGGAAG
  AACATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_008742
• ORF Size: 777 bp
• Insert Size: 777
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_008742.3, NP_032768.1
• RefSeq Size: 1342
• RefSeq ORF: 777
• Locus ID: 18205
• Gene Summary: This gene encodes a member of the neurotrophins that have a wide variety of functions in both neural and non-neural tissues. The encoded preproprotein undergoes proteolytic processing to generate a noncovalently linked homodimeric mature protein that can bind to the transmembrane receptor tyrosine kinases to initiate a series of signaling events. Mice lacking the encoded protein exhibit severe defects in the peripheral nervous system including a complete lack of spinal proprioceptive afferents and their peripheral sense organs. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (3) lacks a portion of the 5' UTR and 5' coding region, and uses a downstream translational start codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a.