Ccl12 (NM_011331) Mouse Untagged Clone

CAT#: MC207390

Ccl12 (untagged) - Mouse chemokine (C-C motif) ligand 12 (Ccl12), (10ug)


  "NM_011331" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ccl12"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ccl12
Synonyms MCP-5; Scya12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207390 representing NM_011331
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATTTCCACACTTCTATGCCTCCTGCTCATAGCTACCACCATCAGTCCTCAGGTATTGGCTGGAC
CAGATGCGGTGAGCACCCCAGTCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCCGGAAGCT
GAAGAGCTACAGGAGAATCACAAGCAGCCAGTGTCCCCGGGAAGCTGTGATCTTCAGGACCATACTGGAT
AAGGAGATCTGTGCTGACCCCAAGGAGAAGTGGGTTAAGAATTCCATAAACCACTTGGATAAGACGTCTC
AAACCTTCATCCTTGAACCTTCATGTCTAGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011331
ORF Size 315 bp
Insert Size 315
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_011331.2, NP_035461.2
RefSeq Size 537
RefSeq ORF 315
Locus ID 20293
Gene Summary Chemotactic factor that attracts eosinophils, monocytes, and lymphocytes but not neutrophils. Potent monocyte active chemokine that signals through CCR2. Involved in allergic inflammation and the host response to pathogens and may play a pivotal role during early stages of allergic lung inflammation. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.