Snca (NM_001042451) Mouse Untagged Clone

CAT#: MC207399

Snca (untagged) - Mouse synuclein, alpha (Snca), transcript variant 1, (10ug)


  "NM_001042451" in other vectors (5)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Snca"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snca
Synonyms alpha-Syn; alphaSYN; NACP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207399 representing NM_001042451
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGTGTTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAGC
AGGGTGTGGCAGAGGCAGCTGGAAAGACAAAAGAGGGAGTCCTCTATGTAGGTTCCAAAACTAAGGAAGG
AGTGGTTCATGGAGTGACAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTG
GTGACTGGTGTGACAGCAGTCGCTCAGAAGACAGTGGAGGGAGCTGGGAATATAGCTGCTGCCACTGGCT
TTGTCAAGAAGGACCAGATGGGCAAGGGTGAGGAGGGGTACCCACAGGAAGGAATCCTGGAAGACATGCC
TGTGGATCCTGGCAGTGAGGCTTATGAAATGCCTTCAGAGGAAGGCTACCAAGACTATGAGCCTGAAGCC
TAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001042451
ORF Size 423 bp
Insert Size 423
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC046764, AAH46764
RefSeq Size 1047
RefSeq ORF 423
Locus ID 20617
Gene Summary May be involved in the regulation of dopamine release and transport. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.