Srp9 (NM_012058) Mouse Untagged Clone

CAT#: MC207470

Srp9 (untagged) - Mouse signal recognition particle 9 (Srp9), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Srp9
• Synonyms: 9kDa
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207470 representing NM_012058
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCCTCAGTTCCAGACCTGGGAGGAGTTCAGCCGGGCGGCCGAGAAGCTCTACCTGGCGGACCCCATGA
  AGGTACGGGTGGTTCTCAAATACAGGCATGTTGATGGGAATTTGTGTATCAAAGTAACGGATGATCTAGT
  TTGTTTGGTGTACAGAACAGACCAAGCGCAAGACGTAAAGAAGATTGAGAAATTCCACAGTCAGTTAATG
  CGACTTATGGTGGCCAAGGAATCCCGCAATGTCACTATGGAAACAGAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012058
• ORF Size: 261 bp
• Insert Size: 261
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_012058.3, NP_036188.1
• RefSeq Size: 1388
• RefSeq ORF: 261
• Locus ID: 27058
• Gene Summary: Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding. [UniProtKB/Swiss-Prot Function]