Mrps21 (NM_078479) Mouse Untagged Clone

CAT#: MC207573

Mrps21 (untagged) - Mouse mitochondrial ribosomal protein S21 (Mrps21), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_078479" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Mrps21"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mrps21
Synonyms 1810031B19Rik; S21mt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207573 representing NM_078479
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAAACATCTGAAGTTCATTGCCAGGACAGTGATGGTTCAGGAGGGGAACGTGGAAGGTGCCTACC
GGACCCTGAACAGAATCCTCACCACGGATGGGCTTACCGAAGTCATAAGTCGACGACGCTACTATGAGAA
GCCTTGCCGCCGCCGCCAGCGGGAGAGCTATGAAACATGCCGGAGGATCTACAACATGGAAATGGCTCGA
AAGATTAACTTCTTGATGCGAAAGAACCGTGCAGACCCGTGGCTGGGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_078479
ORF Size 264 bp
Insert Size 264
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_078479.3, NP_510964.1
RefSeq Size 423
RefSeq ORF 264
Locus ID 66292

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.