Rps20 (NM_026147) Mouse Untagged Clone

CAT#: MC207625

Rps20 (untagged) - Mouse ribosomal protein S20 (Rps20), (10ug)


  "NM_026147" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rps20"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rps20
Synonyms 4632426K06Rik; Dsk4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207625 representing NM_026147
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATTTAAAGATACCGGAAAGACGCCCGTGGAGCCCGAAGTGGCGATTCACCGAATTCGAATCACGC
TCACCAGCCGCAACGTGAAGTCGCTGGAGAAGGTTTGTGCGGACTTGATCAGAGGCGCCAAGGAAAAGAA
TCTGAAAGTGAAAGGACCGGTGCGCATGCCTACCAAGACTTTGAGAATCACTACCAGAAAAACACCTTGT
GGTGAAGGTTCCAAGACCTGGGATCGATTCCAGATGAGGATCCACAAGCGACTCATTGATTTACATAGTC
CTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCGGGAGTTGAGGTTGAAGTCACCATTGC
AGATGCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026147
ORF Size 360 bp
Insert Size 360
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_026147.6, NP_080423.1
RefSeq Size 3446
RefSeq ORF 360
Locus ID 67427
Gene Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.