Rpl38 (NM_001048058) Mouse Untagged Clone

CAT#: MC207632

Rpl38 (untagged) - Mouse ribosomal protein L38 (Rpl38), transcript variant 3, (10ug)


  "NM_001048058" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rpl38"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rpl38
Synonyms 0610025G13Rik; Rbt; Ts; Tss
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207632 representing NM_001048058
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTCGGAAAATTGAGGAGATCAAGGACTTTCTGCTGACAGCCCGGCGGAAGGATGCCAAGTCTGTCA
AGATCAAGAAGAACAAGGATAATGTGAAGTTCAAGGTTCGCTGCAGCAGGTACCTTTACACCCTGGTTAT
CACAGACAAGGAAAAGGCAGAGAAGCTGAAGCAGTCCCTACCCCCGGGTTTGGCAGTGAAGGATCTGAAA
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001048058
ORF Size 213 bp
Insert Size 213
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001048058.1, NP_001041523.1
RefSeq Size 313
RefSeq ORF 213
Locus ID 67671

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.