Elob (NM_026305) Mouse Untagged Clone

CAT#: MC207633

Tceb2 (untagged) - Mouse transcription elongation factor B (SIII), polypeptide 2 (Tceb2), (10ug)


  "NM_026305" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Elob"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Elob
Synonyms 0610040H15Rik; Tceb2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207633 representing NM_026305
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTGTTTCTCATGATCCGGCGCCACAAGACCACCATCTTTACGGACGCCAAGGAGTCGAGCACCG
TGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCGCCAGAGGAGCAGCGGCTTTACAAGGA
TGACCAGCTCCTTGATGATGGCAAAACTCTGGGCGAGTGTGGCTTCACTAGCCAGACAGCACGGCCACAG
GCCCCAGCCACAGTGGGCCTGGCCTTCCGAGCAGATGACACCTTCGAAGCTCTCCGCATCGAGCCCTTTT
CCAGCCCTCCAGAGCTTCCAGATGTGATGAAGCCACAGGATTCTGGAGGCAGTGCCAATGAACAAGCTGT
GCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026305
ORF Size 357 bp
Insert Size 357
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_026305.2, NP_080581.1
RefSeq Size 508
RefSeq ORF 357
Locus ID 67673
Gene Summary The elongin BC complex seems to be involved as an adapter protein in the proteasomal degradation of target proteins via different E3 ubiquitin ligase complexes, including the von Hippel-Lindau ubiquitination complex CBC(VHL). By binding to BC-box motifs it seems to link target recruitment subunits, like VHL and members of the SOCS box family, to Cullin/RBX1 modules that activate E2 ubiquitination enzymes. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.