Scnm1 (NM_027013) Mouse Untagged Clone

CAT#: MC207680

Scnm1 (untagged) - Mouse sodium channel modifier 1 (Scnm1), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Scnm1
• Synonyms: 3110001I17Rik; Scnm1-ps
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207680 representing NM_027013
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCTTTTAAGAGGGAAGGGGACGACTGGAGTCAACTCAATGTGCTCAAAAAACGGAGAGTTGGGGACC
  TGCTGGCTAGTTACATCCCTGAGGACGAGGCACTGATGCTGCGGGATGGACGCTTTGCTTGTGCCATCTG
  CCCCCATCGACCAGTACTAGACACGCTGGCCATGTTGACAGCCCACCGTGCAGGCAAGAAGCATTTGTCC
  AGTCTGAAGCTTTTCTATGGCAAAAAGCAAACAGGCAAGGGAACAGAGCAAAATCCAAGACAGCAGAACG
  AATTGAAGACAGAAAGCAAAACTGAGGCTCCTTTGCTAACCCAGACTCGAATCATCACCCAGAATGCTCT
  ACACAGAGCTCCCCACTATAACAGTTGCTGCCGGAGGAAGCACAGACCAGAAGCCCCTGCTCCCTCTGTC
  TCCAGTCCTCCTTTGCCAACTGCAGAGGTCCAACTCCAGAGTGCAGAGATCAGTAAGGAACCTGAGCCTA
  GGGAGAGATCAGATGCCAAAGAGTCAGCAGCTCTCTTGGCCTCTGCACCCATGAGCCCCACCAAACGATG
  A
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_027013
• ORF Size: 561 bp
• Insert Size: 561
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_027013.2, NP_081289.2
• RefSeq Size: 888
• RefSeq ORF: 561
• Locus ID: 69269
• Gene Summary: Mutations in the voltage-gated sodium channel gene Scn8a lead to neurological problems in mice. For one particular mutation, Scn8amedJ, mice live to adulthood but have tremors and muscle weakness, among other problems, in all strains except those derived from C57BL6 mice. In these strains, the product of the Scnm1 gene (229 aa) partially overcomes the effects of the Scn8amedJ mutation. However, in C57BL6-derived mice, a one nt change in the penultimate exon creates a premature stop codon, truncating the Scnm1 protein at 186 aa. This truncated protein lacks the ability to overcome the effects of the Scn8amedJ mutation, and these mice suffer paralysis and juvenile death. [provided by RefSeq, Jul 2009]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). The C-terminus of this isoform is truncated compared to that of the same variant in mouse strains not derived from C57BL6. This truncated isoform is not able to counteract the deleterious effects of the Scn8amedJ mutation whereas the longer isoform found in non-C57BL6 strains can partially overcome these effects.