D8Ertd738e (NM_001007571) Mouse Untagged Clone

CAT#: MC207801

D8Ertd738e (untagged) - Mouse DNA segment, Chr 8, ERATO Doi 738, expressed (D8Ertd738e), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: D8Ertd738e
• Synonyms: AA589584
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207801 representing NM_001007571
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGCAGGGACAACGCAAGTTCCAGGCGCAGAAACCTAAAAGCAAGGCTGCCGCGGCGGAGCGGAGCC
  GCGGGCCTCGGAAAGGCGGTCGAGTCATCGCTCCCAAGAAGGCGCGCGTTGTTCAGCAGCAGAAGTTGAA
  GAAGAGCCTGGAAGTGGGAATCCGGAAGAAGATTGAGCATGACGTGGTAATGAAGGCCAGCTCCAGCCTG
  CCTAAGAGGCTTGCACTGCTGAAGGGAGCATCAAAGAAATCAGAAGCCACCATCCCTGGCAAGACACCAT
  CCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007571
• Insert Size: 285 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001007571.2, NP_001007572.1
• RefSeq Size: 679 bp
• RefSeq ORF: 285 bp
• Locus ID: 101966
• Cytogenetics: 8 40.72 cM