Sptssa (NM_134054) Mouse Untagged Clone

CAT#: MC207810

Sptssa (untagged) - Mouse RIKEN cDNA 1110002B05 gene (1110002B05Rik), (10ug)


  "NM_134054" in other vectors (6)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Sptssa"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sptssa
Synonyms 1110002B05Rik; AA407909; AA409588; AU041967; Ssspta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207810 representing NM_134054
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGGCATGGCGCTGGCGCGAGCATGGAAGCAGATGTCCTGGTTCTACTACCAGTACCTGCTGGTCA
CTGCGCTCTACATGCTGGAGCCCTGGGAGCGAACCGTGTTCAATTCGATGCTGGTTTCCGTGGTGGGGAT
GGCCCTGTACACTGGCTACGTCTTCATGCCCCAGCACATCATGGCTATTCTGCATTACTTTGAAATTGTA
CAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_134054
ORF Size 216 bp
Insert Size 216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_134054.2, NP_598815.2
RefSeq Size 1363
RefSeq ORF 216
Locus ID 104725

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.