Srsf1 (NM_173374) Mouse Untagged Clone

CAT#: MC207837

Srsf1 (untagged) - Mouse serine/arginine-rich splicing factor 1 (Srsf1), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Srsf1
• Synonyms: 1110054N12Rik; 5730507C05Rik; 6330415C05Rik; AI482334; Asf; AW491331; Sf2; Sfrs1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC207837 representing NM_173374
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGGGAGGTGGTGTGATCCGTGGCCCGGCGGGGAACAACGACTGCCGCATCTACGTGGGTAACCTAC
  CTCCGGATATCCGAACCAAGGACATCGAGGACGTGTTTTACAAATACGGCGCCATCCGCGACATCGACCT
  GAAGAACCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAGTTCGAGGACCCGCGAGACGCGGAAGATGCG
  GTGTACGGTCGCGACGGCTACGACTACGACGGCTACCGGCTGCGGGTAGAGTTTCCCCGAAGCGGCCGCG
  GGACCGGCCGAGGCGGCGGCGGGGGTGGAGGCGGCGGCGCCCCGAGAGGCCGCTATGGCCCGCCGTCCAG
  GCGGTCCGAGAACAGAGTGGTTGTCTCTGGACTGCCTCCGAGTGGAAGCTGGCAGGACTTAAAGGATCAC
  ATGCGTGAGGCAGGTGATGTATGTTACGCTGATGTTTACCGAGATGGCACTGGTGTCGTGGAGTTTGTAC
  GGAAAGAAGATATGACGTATGCAGTTCGAAAACTGGATAACACTAAGTTTAGATCTCACGAGGGAGAAAC
  TGCCTACATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCAAGTTATGGAAGATCTCGATCTCGAAGCCGT
  AGTCGTAGCAGAAGCCGTAGCAGAAGCAACAGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGAT
  CACCACGCTATTCTCCCCGTCATAGCAGATCTCGCTCTCGTACATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_173374
• ORF Size: 747 bp
• Insert Size: 747
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_173374.4, NP_775550.2
• RefSeq Size: 5364
• RefSeq ORF: 747
• Locus ID: 110809
• Gene Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
  Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.