Qrfp (NM_183424) Mouse Untagged Clone

CAT#: MC207900

Qrfp (untagged) - Mouse pyroglutamylated RFamide peptide (Qrfp), (10ug)


  "NM_183424" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Qrfp"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Qrfp
Synonyms P518
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207900 representing NM_183424
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGGGCTTCCGGCCTTTGCTTTCCCTACTTCTCCCTCTGAGTGCCTGCTTTCCCCTGCTGGACAGAA
GGGGACCCACAGACATCGGTGACATCGGAGCCAGGATGAGCTGGGCCCAGCTGGCTGAGGGACACCCCCC
CAACTCGGTTCAAAATCCACAGCCACAGGCCCTGCTTGTGGTGGCCAAGGAGCAGCAGGCCTCCCACAGG
GAGCACACCGGCTTCCGTCTAGGGAGGCAAGACGGTAGCAGTGAGGCCGCAGGGTTCCTGCCCGCCGACT
CGGAGAAGGCCAGCGGCCCTCTGGGGACTCTGGCAGAGGAGCTGAGCAGCTACAGCCGGAGGAAGGGAGG
CTTCAGCTTCCGCTTTGGACGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_183424
ORF Size 375 bp
Insert Size 375
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC094274, AAH94274
RefSeq Size 889
RefSeq ORF 375
Locus ID 227717
Gene Summary This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. The encoded products are members of the RFamide family of neuropeptides, characterized by their common protein C-terminus consisting of an arginine (R) and an amidated phenylalanine (F). These products include the neuropeptides QRFP-26 (26RFa) and the N-terminally extended form, QRFP-43 (43RFa). Both of these neuropeptides bind to the pyroglutamylated RFamide peptide receptor (QRFPR) and may regulate blood pressure, reproduction and food intake. [provided by RefSeq, Sep 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.