Hbegf (NM_010415) Mouse Untagged Clone

CAT#: MC208020

Hbegf (untagged) - Mouse heparin-binding EGF-like growth factor (Hbegf), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hbegf
• Synonyms: AW047313; Dtr; Dts; Hegfl
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208020 representing NM_010415
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGCTGCTGCCGTCGGTGATGCTGAAGCTCTTTCTGGCCGCAGTGTTGTCCGCGTTGGTGACCGGTG
  AGAGTCTGGAGCGGCTTCGGAGAGGTCTGGCGGCAGCAACCAGCAACCCTGACCCTCCCACTGGATCCAC
  AAACCAGCTGCTACCCACGGGAGGTGATCGTGCTCAGGGGGTCCAGGACTTGGAAGGGACAGATCTGAAC
  CTTTTCAAAGTTGCTTTCTCCTCCAAGCCACAAGGCCTGGCCACCCCAAGCAAAGAAAGGAATGGGAAAA
  AGAAGAAGAAAGGAAAGGGGTTAGGGAAGAAGAGAGACCCATGCCTCAGGAAATACAAGGACTACTGCAT
  CCACGGGGAGTGCAGATACCTGCAGGAGTTCCGTACTCCCTCTTGCAAATGCCTCCCTGGTTACCACGGA
  CACAGGTGTCATGGGCTGACTCTACCAGTGGAGAATCCCCTATACACATATGACCACACTACAGTCTTGG
  CTGTGGTGGCTGTAGTACTGTCGTCCGTCTGTCTTCTTGTCATCGTGGGACTTCTCATGTTTAGGTACCA
  CAGGAGAGGAGGTTATGACTTGGAAAGTGAAGAGAAAGTGAAGTTGGGCGTGGCTAGCTCCCACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010415
• ORF Size: 627 bp
• Insert Size: 627
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_010415.1, NP_034545.1
• RefSeq Size: 2337
• RefSeq ORF: 627
• Locus ID: 15200
• Gene Summary: Growth factor that mediates its effects via EGFR, ERBB2 and ERBB4. Required for normal cardiac valve formation and normal heart function. Promotes smooth muscle cell proliferation. May be involved in macrophage-mediated cellular proliferation. It is mitogenic for fibroblasts, but not endothelial cells. It is able to bind EGF receptor/EGFR with higher affinity than EGF itself and is a far more potent mitogen for smooth muscle cells than EGF. Also acts as a diphtheria toxin receptor. [UniProtKB/Swiss-Prot Function]