Hmgb1 (NM_010439) Mouse Untagged Clone

CAT#: MC208023

Hmgb1 (untagged) - Mouse high mobility group box 1 (Hmgb1), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Hmgb1
• Synonyms: HMG-1; Hmg1; p30; SBP-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC206835 representing BC110667
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGCAAAGGAGATCCTAAGAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACTTGCC
  GGGAGGAGCACAAGAAGAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCAGA
  GAGGTGGAAGACCATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCTCGT
  TATGAAAGAGAAATGAAAACCTACATCCCCCCCAAAGGGGAGACCAAAAAGAAGTTCAAGGACCCCAATG
  CACCCAAGAGGCCTCCTTCGGCCTTCTTCTTGTTCTGTTCTGAGTACCGCCCCAAAATCAAAGGCGAGCA
  TCCTGGCTTATCCATTGGTGATGTTGCAAAGAAACTAGGAGAGATGTGGAACAACACTGCAGCAGATGAC
  AAGCAGCCCTATGAGAAGAAAGCTGCCAAGCTGAAGGAGAAGTATGAGAAGGATATTGCTGCCTACAGAG
  CTAAAGGAAAACCTGATGCAGCGAAAAAGGGGGTGGTCAAGGCTGAAAAGAGCAAGAAAAAGAAGGAAGA
  GGAAGATGATGAGGAGGATGAAGAGGATGAGGAAGAGGAGGAAGAAGAGGAAGACGAAGATGAAGAAGAA
  GATGATGATGATGAATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_010439
• ORF Size: 648 bp
• Insert Size: 648
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_010439.4, NP_034569.1
• RefSeq Size: 2327
• RefSeq ORF: 648
• Locus ID: 15289
• Gene Summary: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.