Tmsb10 (NM_025284) Mouse Untagged Clone

CAT#: MC208040

Tmsb10 (untagged) - Mouse thymosin, beta 10 (Tmsb10), (10ug)


  "NM_025284" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Tmsb10"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tmsb10
Synonyms Ptmb10; Tb10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208040 representing NM_025284
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGACAAGCCGGACATGGGGGAAATCGCCAGCTTCGATAAGGCCAAGCTGAAGAAAACCGAGACGC
AGGAGAAGAACACCCTGCCGACCAAAGAGACCATTGAACAGGAAAAGAGGAGTGAAATCTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025284
ORF Size 135 bp
Insert Size 135
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_025284.4, NP_079560.1
RefSeq Size 565
RefSeq ORF 135
Locus ID 19240

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.