Aanat (NM_009591) Mouse Untagged Clone

CAT#: MC208096

Aanat (untagged) - Mouse arylalkylamine N-acetyltransferase (Aanat), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Aanat
• Synonyms: AA-NAT; Nat-2; Nat4; Snat
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208096 representing NM_009591
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTTGAACATCAACTCCCTGAAACCTGAGGCCCTGCACCTGCCACTTGGGACCTCAGAGTTCCTAGGCT
  GCCAGCGGCGCCACACACTCCCTGCCAGTGAGTTCCGCTGCCTCACACCTGAGGATGCCACCAGTGCGTT
  TGAGATTGAGCGGGAAGCCTTTATCTCTGTCTCCGGTACCTGTCCCCTCTACTTGGATGAGATCCGGCAC
  TTCCTAACCCTGTGTCCAGAGCTGTCACTGGGCTGGTTTGAGGAAGGCTGCCTTGTGGCCTTCATCATTG
  GCTCGCTGTGGGACAAGGAGAGACTTACTCAGGAGTCGCTGACACTACACAGGCCCGGAGGCCGCACAGC
  CCACCTGCACGTACTGGCGGTGCACAGAACCTTCCGGCAGCAGGGCAAGGGCTCTGTCCTCCTGTGGAGA
  TACCTTCACCACCTGGGCAGTCAGCCGGCCGTGCGCCGGGCTGTGCTCATGTGTGAGGATGCCCTGGTAC
  CCTTCTATGAGAAATTTGGCTTCCAGGCTGTGGGCCCATGTGCCATCACCGTGGGCTCTCTCACCTTCAC
  GGAGCTACAGTGTTCCTTACGATGCCACGCCTTCCTGCGCAGGAACAGCGGCTGCTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009591
• ORF Size: 618 bp
• Insert Size: 618
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_009591.3, NP_033721.1
• RefSeq Size: 1370
• RefSeq ORF: 618
• Locus ID: 11298
• Gene Summary: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
  Transcript Variant: This variant (1) represents the shorter and protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.