Birc5 (NM_009689) Mouse Untagged Clone

CAT#: MC208134

Birc5 (untagged) - Mouse baculoviral IAP repeat-containing 5 (BIRC5/Survivin), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Birc5
• Synonyms: AAC-11; Api4; survivin40; TIAP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208134 representing NM_009689
  Red=Cloning site Blue=ORF
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGGAGCTCCGGCGCTGCCCCAGATCTGGCAGCTGTACCTCAAGAACTACCGCATCGCCACCTTCAAGA
  ACTGGCCCTTCCTGGAGGACTGCGCCTGCACCCCAGAGCGAATGGCGGAGGCTGGCTTCATCCACTGCCC
  TACCGAGAACGAGCCTGATTTGGCCCAGTGTTTTTTCTGCTTTAAGGAATTGGAAGGCTGGGAACCCGAT
  GACAACCCGATAGAGGAGCATAGAAAGCACTCCCCTGGCTGCGCCTTCCTCACTGTCAAGAAGCAGATGG
  AAGAACTAACCGTCAGTGAATTCTTGAAACTGGACAGACAGAGAGCCAAGAACAAAATTGCAAAGGAGAC
  CAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCC
  TAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_009689
• ORF Size: 423 bp
• Insert Size: 423
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_009689.2, NP_033819.1
• RefSeq Size: 977
• RefSeq ORF: 423
• Locus ID: 11799
• Gene Summary: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. In humans, gene expression is high during fetal development and in most tumors yet low in adult tissues. Antisense transcripts have been identified in human that regulate this gene's expression. At least three transcript variants encoding distinct isoforms have been found for this gene, although at least one of these transcript variants is a nonsense-mediated decay (NMD) candidate. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1), also known as survivin140, represents the most frequently occurring transcript and it encodes isoform 1.