Artn (NM_009711) Mouse Untagged Clone

CAT#: MC208157

Artn (untagged) - Mouse artemin (Artn), (10ug)


  "NM_009711" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Artn"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Artn
Synonyms neublastin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208157 representing NM_009711
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAACTGGGACTTGCAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAGTCAGCCTGGT
GGCCAACCCTAGCTGTTCTAGCCCTGCTGAGCTGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG
CCCCGCCGCTCGCGACGGTCCCTCACCGGTCTTGGCGCCCCCCACGGACCACCTGCCTGGGGGACACACT
GCGCATTTGTGCAGCGAAAGAACCCTGCGACCCCCGCCTCAGTCTCCTCAGCCCGCACCCCCGCCGCCTG
GTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGAGCAG
CCGCGCACGGACCACAGATGCGCGCGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTGAGTGCGCTCGGC
CTAGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGCTCGTGCCGCCGAGCACGCTCCC
AGCACGATCTCAGTCTGGCCAGCCTACTGGGCGCTGGGGCCCTACGGTCGCCTCCCGGGTCCCGGCCGAT
CAGCCAGCCCTGCTGCCGGCCCACTCGCTATGAGGCCGTCTCCTTCATGGACGTGAACAGCACCTGGAGG
ACCGTGGACCACCTCTCCGCCACTGCCTGCGGCTGTCTGGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009711
ORF Size 675 bp
Insert Size 675
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009711.4, NP_033841.1
RefSeq Size 2179
RefSeq ORF 675
Locus ID 11876
Gene Summary This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. Mice lacking a functional copy of this gene exhibit ptosis and impaired development of the sympathetic nervous system. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.