Atp6v0c (NM_009729) Mouse Untagged Clone

CAT#: MC208166

Atp6v0c (untagged) - Mouse ATPase, H+ transporting, lysosomal V0 subunit C (Atp6v0c), (10ug)


  "NM_009729" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Atp6v0c"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Atp6v0c
Synonyms Atp6c; Atp6c2; Atp6l; Atpl; Atpl-rs1; PL16; VATL; Vma3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208166 representing NM_009729
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGACATCAAGAACAACCCCGAATATTCTTCGTTTTTCGGTGTCATGGGCGCCTCGTCCGCCATGG
TCTTCAGCGCCATGGGAGCCGCCTATGGCACAGCCAAGAGTGGCACTGGCATCGCAGCCATGTCAGTCAT
GAGGCCAGAGCTGATCATGAAGTCCATCATCCCAGTGGTTATGGCTGGGATCATCGCCATCTACGGCCTG
GTGGTGGCAGTACTTATCGCTAACTCCCTGACTGATGGCATCACCCTCTACAGGAGTTTTCTTCAACTGG
GTGCTGGCCTGAGTGTGGGGCTGAGTGGCCTGGCTGCTGGCTTTGCCATTGGCATCGTCGGAGATGCTGG
TGTTCGGGGCACTGCCCAGCAGCCTCGACTGTTCGTGGGCATGATCCTGATCCTCATCTTTGCGGAGGTG
CTTGGCCTCTACGGTCTCATCGTGGCCCTAATCCTCTCCACAAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009729
ORF Size 468 bp
Insert Size 468
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009729.3, NP_033859.1
RefSeq Size 1151
RefSeq ORF 468
Locus ID 11984
Gene Summary Proton-conducting pore forming subunit of the membrane integral V0 complex of vacuolar ATPase. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.