Bad (NM_007522) Mouse Untagged Clone

CAT#: MC208172

Bad (untagged) - Mouse BCL2-associated agonist of cell death (Bad), (10ug)


  "NM_007522" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bad
Synonyms AI325008; Bbc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208172 representing NM_007522
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGAACCCCAAAGCAGCCCTCGCTGGCTCCTGCACACGCCCTAGGCTTGAGGAAGTCCGATCCCGGAA
TCCGGAGCCTGGGGAGCGACGCGGGAGGAAGGCGGTGGAGACCAGCAGCCCAGAGTATGTTCCAGATCCC
AGAGTTTGAGCCGAGTGAGCAGGAAGACGCTAGTGCTACAGATAGGGGCCTGGGCCCTAGCCTCACTGAG
GACCAGCCAGGTCCCTACCTGGCCCCAGGTCTCCTGGGGAGCAACATTCATCAGCAGGGACGGGCAGCCA
CCAACAGTCATCATGGAGGCGCAGGGGCTATGGAGACTCGGAGTCGCCACAGTTCGTACCCAGCGGGGAC
CGAGGAGGATGAAGGGATGGAGGAGGAGCTTAGCCCTTTTCGAGGACGCTCGCGTTCGGCTCCCCCCAAT
CTCTGGGCAGCGCAGCGCTACGGCCGTGAGCTCCGAAGGATGAGCGATGAGTTTGAGGGTTCCTTCAAGG
GACTTCCTCGCCCAAAGAGCGCAGGCACTGCAACACAGATGCGACAAAGCGCCGGCTGGACGCGCATTAT
CCAGTCCTGGTGGGATCGAAACTTGGGCAAAGGAGGCTCCACCCCCTCCCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_007522
ORF Size 615 bp
Insert Size 615
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_007522.3, NP_031548.1
RefSeq Size 1458
RefSeq ORF 615
Locus ID 12015
Gene Summary Promotes cell death. Successfully competes for the binding to Bcl-X(L), Bcl-2 and Bcl-W, thereby affecting the level of heterodimerization of these proteins with BAX. Can reverse the death repressor activity of Bcl-X(L), but not that of Bcl-2. Appears to act as a link between growth factor receptor signaling and the apoptotic pathways. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.