Bglap (NM_007541) Mouse Untagged Clone

CAT#: MC208188

Bglap (untagged) - Mouse bone gamma carboxyglutamate protein (Bglap), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Bglap
• Synonyms: Bglap1; BGP; mOC-A; OC; OG1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NM_007541.2
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAGGACCATCTTTCTGCTCACTCTGCTGACCCTGGCTGCGCTCTGTCTCTCTGACCTCACAGATGCCA
  AGCCCAGCGGCCCTGAGTCTGACAAAGCCTTCATGTCCAAGCAGGAGGGCAATAAGGTAGTGAACAGACT
  CCGGCGCTACCTTGGAGCCTCAGTCCCCAGCCCAGATCCCCTGGAGCCCACCCGGGAGCAGTGTGAGCTT
  AACCCTGCTTGTGACGAGCTATCAGACCAGTATGGCTTGAAGACCGCCTACAAACGCATCTATGGTATCA
  CTATTTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_007541
• ORF Size: 288 bp
• Insert Size: 288
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_007541.2, NP_031567.1
• RefSeq Size: 494
• RefSeq ORF: 288
• Locus ID: 12096
• Gene Summary: This gene encodes one of the most abundant non-collagenous proteins in bone tissue that is localized to the mineralized matrix of bone. The encoded preproprotein undergoes proteolytic processing and post-translational gamma carboxylation to generate a mature, calcium-binding protein. Mice lacking the encoded protein develop abnormalities of bone remodelling. This gene is located adjacent to two other osteocalcin-related genes on chromosome 3. [provided by RefSeq, Oct 2015]