Ctla4 (NM_009843) Mouse Untagged Clone

CAT#: MC208240

Ctla4 (untagged) - Mouse cytotoxic T-lymphocyte-associated protein 4 (Ctla4), (10ug)


  "NM_009843" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Ctla4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ctla4
Synonyms Cd152; Ctla-4; Ly-56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_009843, the custom clone sequence may differ by one or more nucleotides


ATGGCTTGTCTTGGACTCCGGAGGTACAAAGCTCAACTGCAGCTGCCTTCTAGGACTTGGCCTTTTGTAG
CCCTGCTCACTCTTCTTTTCATCCCAGTCTTCTCTGAAGCCATACAGGTGACCCAACCTTCAGTGGTGTT
GGCTAGCAGCCATGGTGTCGCCAGCTTTCCATGTGAATATTCACCGTCACACAACACTGATGAGGTCCGG
GTGACTGTGCTGCGGCAGACAAATGACCAAATGACTGAGGTCTGTGCCACGACATTCACAGAGAAGAATA
CAGTGGGCTTCCTAGATTACCCCTTCTGCAGTGGTACCTTTAATGAAAGCAGAGTGAACCTCACCATCCA
AGGACTGAGAGCTGTTGACACGGGACTGTACCTCTGCAAGGTGGAACTCATGTACCCACCGCCATACTTT
GTGGGCATGGGCAACGGGACGCAGATTTATGTCATTGATCCAGAACCATGCCCGGATTCTGACTTCCTCC
TTTGGATCCTTGTCGCAGTTAGCTTGGGGTTGTTTTTTTACAGTTTCCTGGTCACTGCTGTTTCTTTGAG
CAAGATGCTAAAGAAAAGAAGTCCTCTTACAACAGGGGTCTATGTGAAAATGCCCCCAACAGAGCCAGAA
TGTGAAAAGCAATTTCAGCCTTATTTTATTCCCATCAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_009843
ORF Size 672 bp
Insert Size 672
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC042741, AAH42741
RefSeq Size 1958
RefSeq ORF 672
Locus ID 12477
Gene Summary This gene is a member of the immunoglobulin superfamily, and encodes a protein that functions as a negative regulator of T-cell responses. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (1) encodes the longer membrane-bound isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.