Cd247 (NM_001113393) Mouse Untagged Clone

CAT#: MC208248

Cd247 (untagged) - Mouse CD247 antigen (Cd247), transcript variant theta, (10ug)


  "NM_001113393" in other vectors (4)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cd247"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cd247
Synonyms 4930549J05Rik; A430104F18Rik; AW552088; Cd3; Cd3-eta; Cd3-zeta; Cd3h; Cd3z; Cd3zeta; T3z; Tcrk; Tcrz
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208248 representing NM_001113393
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTGGAAAGTGTCTGTTCTCGCCTGCATCCTCCACGTGCGGTTCCCAGGAGCAGAGGCACAGAGCT
TTGGTCTGCTGGATCCCAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGGAGTCATCATCAC
AGCCCTGTACCTGAGAGCAAAATTCAGCAGGAGTGCAGAGACTGCTGCCAACCTGCAGGACCCCAACCAG
CTCTACAATGAGCTCAATCTAGGGCGAAGAGAGGAATATGACGTCTTGGAGAAGAAGCGGGCTCGGGATC
CAGAGATGGGAGGCAAACAGAGGAGGAGGAACCCCCAGGAAGGCGTATACAATGCACTGCAGAAAGACAA
GATGGCAGAAGCCTACAGTGAGATCGGCACAAAAGGCGAGAGGCGGAGAGGCAAGGGGCACGATGGCCTT
TACCAGGACAGCCACTTCCAAGCAGTGCAGTTCGGGAACAGAAGAGAGAGAGAAGGTTCAGAACTCACAA
GGACCCTTGGGTTAAGAGCCCGCCCCAAAGCCTGCCGACATAAGAAGCCTCTTAGCCTCCCAGCAGCCGT
ATCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001113393
ORF Size 567 bp
Insert Size 567
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001113393.2, NP_001106864.2
RefSeq Size 2804
RefSeq ORF 567
Locus ID 12503
Gene Summary Probable role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (theta) uses an alternate in-frame splice site in the central coding region, and has alternate exon structure in the 3' coding region and 3' UTR, compared to variant zeta. The resulting isoform (theta) has a distinct C-terminus and is longer than isoform zeta. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.