Cdx2 (NM_007673) Mouse Untagged Clone

CAT#: MC208274

Cdx2 (untagged) - Mouse caudal type homeobox 2 (Cdx2), (10ug)


  "NM_007673" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Cdx2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cdx2
Synonyms Cdx-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_007673, the custom clone sequence may differ by one or more nucleotides


ATGTACGTGAGCTACCTTCTGGACAAGGACGTGAGCATGTATCCTAGCTCCGTGCGCCACTCCGGCGGCC
TGAACCTGGCTCCGCAGAACTTTGTCAGTCCTCCGCAGTACCCGGACTACGGTGGTTACCACGTGGCGGC
CGCGGCGGCTGCTACGGCGAACTTGGACAGCGCTCAGTCCCCAGGGCCATCCTGGCCCACCGCGTACGGC
GCCCCTCTCCGCGAGGACTGGAATGGCTACGCACCCGGGGGCGCTGCGGCAGCCAACGCGGTAGCCCACG
GTCTCAATGGTGGCTCCCCGGCCGCCGCTATGGGCTACAGCAGCCCCGCCGAATACCACGCGCACCATCA
CCCGCATCATCACCCGCACCATCCGGCCGCCTCGCCGTCCTGCGCCTCCGGCTTGCTGCAGACGCTCAAC
CTCGGCCCCCCGGGGCCCGCAGCCACCGCCGCCGCCGAACAGCTGTCCCCCAGCGGCCAGCGGCGAAACC
TGTGCGAGTGGATGCGGAAGCCCGCGCAGCAGTCCCTAGGAAGCCAAGTGAAAACCAGGACAAAAGACAA
ATACCGGGTGGTGTACACAGACCATCAGCGGCTGGAGCTGGAGAAGGAGTTTCACTTTAGTCGATACATC
ACCATCAGGAGGAAAAGTGAGCTGGCTGCCACACTTGGGCTCTCCGAGAGGCAGGTTAAAATTTGGTTTC
AGAACCGCAGAGCCAAGGAGAGGAAAATCAAGAAGAAGCAGCAGCAGCAACAGCAGCAGCAGCAACAACA
GCCTCCACAGCCGCCGCCACAACCTTCCCAGCCTCAGCCGGGTGCCCTGCGGAGCGTGCCGGAGCCCTTG
AGTCCTGTGACCTCCTTGCAAGGCTCAGTGCCTGGTTCTGTCCCTGGGGTTCTGGGGCCAGCTGGAGGGG
TTTTAAACTCCACTGTCACCCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_007673
ORF Size 936 bp
Insert Size 936
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq BC103517, AAI03518
RefSeq Size 1834
RefSeq ORF 936
Locus ID 12591
Gene Summary Involved in the transcriptional regulation of multiple genes expressed in the intestinal epithelium. Important in broad range of functions from early differentiation to maintenance of the intestinal epithelial lining of both the small and large intestine. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.