Cox7a1 (NM_009944) Mouse Untagged Clone

CAT#: MC208310

Cox7a1 (untagged) - Mouse cytochrome c oxidase, subunit VIIa 1 (Cox7a1), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_009944" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cox7a1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cox7a1
Synonyms COX7A; COX7AH; COX7AM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208310 representing NM_009944
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGGCCCTACGGGTCTCCCAGGCTCTGGTCCGGTCTTTTAGCTCATCTACCAGAAGCCACTTAGAAA
ACCGTGTGGCAGAGAAGCAGAAGCTCTTCCAGGCCGACAATGACCTCCCAGTACACTTGAAAGGCGGGGG
AATGGACAACGTCCTGTACAGACTGACCATGACGCTGACTCTGGGGGGCACTGCCTACTGCTTATACTGC
TTGGGCTGGGCCTCCTTCCCCCACAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009944
ORF Size 243 bp
Insert Size 243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009944.3, NP_034074.1
RefSeq Size 393
RefSeq ORF 243
Locus ID 12865
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.