Crabp1 (NM_013496) Mouse Untagged Clone

CAT#: MC208317

Crabp1 (untagged) - Mouse cellular retinoic acid binding protein I (Crabp1), (10ug)


  "NM_013496" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Crabp1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Crabp1
Synonyms AI326249; Crabp-1; CRABP-I; CrabpI; Rbp-5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208317 representing NM_013496
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCAACTTCGCCGGTACCTGGAAGATGCGCAGCAGCGAGAATTTCGACGAGCTCCTCAAGGCGTTGG
GTGTGAACGCCATGCTGAGGAAGGTGGCCGTGGCGGCTGCGTCTAAGCCGCACGTGGAGATCCGCCAAGA
CGGGGATCAGTTCTACATCAAGACATCCACTACTGTGCGCACCACGGAGATCAACTTCAAGGTCGGAGAG
GGCTTCGAGGAGGAGACAGTGGACGGACGCAAATGCAGGAGTTTACCCACGTGGGAGAATGAGAACAAGA
TTCACTGCACACAGACACTTCTTGAGGGGGATGGCCCTAAAACTTACTGGACCCGAGAGCTGGCCAACGA
TGAGCTAATCCTGACATTTGGCGCCGATGATGTGGTGTGCACAAGAATTTATGTCCGGGAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013496
ORF Size 414 bp
Insert Size 414
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_013496.3, NP_038524.1
RefSeq Size 819
RefSeq ORF 414
Locus ID 12903
Gene Summary Cytosolic CRABPs may regulate the access of retinoic acid to the nuclear retinoic acid receptors. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.