Crh (NM_205769) Mouse Untagged Clone

CAT#: MC208331

Crh (untagged) - Mouse corticotropin releasing hormone (Crh), (10ug)


  "NM_205769" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Crh
Synonyms CRF; Gm1347
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208331 representing NM_205769
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGCTGCGGCTGCTGGTGTCCGCGGGCATGCTGCTGGTGGCTCTGTCGTCCTGCCTGCCTTGCAGGG
CCCTGCTCAGCAGGGGATCCGTCCCCCGAGCGCCGCGGGCCCCGCAGCCCTTGAATTTCTTGCAGCCGGA
GCAGCCCCAGCAACCTCAGCCGGTTCTGATCCGCATGGGTGAAGAATACTTCCTCCGCCTGGGGAATCTC
AACAGAAGTCCCGCTGCTCGGCTGTCCCCCAACTCCACGCCCCTCACCGCGGGTCGCGGCAGCCGCCCCT
CGCACGACCAGGCTGCGGCTAACTTTTTCCGCGTGTTGCTGCAGCAGCTGCAGATGCCTCAGCGCTCGCT
CGACAGCCGCGCGGAGCCGGCCGAACGCGGCGCCGAGGATGCCCTCGGTGGCCACCAGGGGGCGCTGGAG
AGGGAGAGGCGGTCGGAGGAGCCGCCCATCTCTCTGGATCTCACCTTCCACCTTCTGCGGGAAGTCTTGG
AAATGGCCCGGGCAGAGCAGTTAGCTCAGCAAGCTCACAGCAACAGGAAACTGATGGAGATTATCGGGAA
ATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_205769
ORF Size 564 bp
Insert Size 564
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_205769.3, NP_991338.1
RefSeq Size 1320
RefSeq ORF 564
Locus ID 12918
Gene Summary This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.