Cryba1 (NM_009965) Mouse Untagged Clone

CAT#: MC208338

Cryba1 (untagged) - Mouse crystallin, beta A1 (Cryba1), (10ug)


  "NM_009965" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cryba1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cryba1
Synonyms BA3/A1; Cryb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208338 representing NM_009965
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGACCCAGACTGTGCAGCGGGAGTTGGAAACTCTTCCAACCACCAAGATGGCTCAGACCAACCCTA
TGCCAGGATCCTTGGGGCCATGGAAGATAACCATCTACGATCAAGAGAACTTCCAGGGCAAGAGGATGGA
GTTCACCAGCTCCTGCCCAAATGTCTCTGAACGTAATTTTGATAATGTCCGGTCACTTAAGGTGGAGTGT
GGCGCCTGGATTGGTTATGAACACACCAGCTTCTGTGGGCAACAGTTCATCCTGGAAAGAGGAGAATACC
CTCGATGGGATGCCTGGAGCGGGAGCAATGCCTATCATATTGAGCGTCTCATGTCCTTCCGACCCATCTG
TTCCGCTAATCATAAAGAGTCTAAGATTACCATCTTCGAGAAAGAGAACTTTATTGGACGCCAGTGGGAA
ATCTGTGATGACTACCCTTCCTTGCAAGCCATGGGTTGGTTCAACAATGAAGTTGGTTCCATGAAGATAC
AATGTGGGGCCTGGGTTTGCTACCAGTACCCTGGATATCGTGGTTATCAGTATATCTTGGAGTGTGACCA
CCATGGAGGAGACTACAAGCACTGGCCAGAGTGGGGATCTCACGCCCAGACTTCCCAGATCCAATCAATT
CGCCGAATACAACAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009965
ORF Size 648 bp
Insert Size 648
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_009965.3, NP_034095.1
RefSeq Size 819
RefSeq ORF 648
Locus ID 12957
Gene Summary Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.