Dazl (NM_010021) Mouse Untagged Clone

CAT#: MC208363

Dazl (untagged) - Mouse deleted in azoospermia-like (Dazl), (10ug)


  "NM_010021" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Dazl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dazl
Synonyms Daz-like; Dazh; Dazl1; Dazla; Tpx-2; Tpx2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_010021, the custom clone sequence may differ by one or more nucleotides


ATGTCTGCCACAACTTCTGAGGCTCCAAATTCAGCTGTCTCCAGGGAGGCCAGCACTCAGTCTTCATCAG
CAACCACAAGTCAAGGATATGTTTTGCCAGAAGGCAAAATCATGCCAAACACCGTTTTTGTTGGAGGAAT
TGATGTTAGGATGGATGAAACCGAAATCAGGAGTTTCTTTGCCAGATATGGCTCAGTAAAAGAAGTGAAG
ATAATCACTGATCGAACTGGTGTGTCGAAGGGCTATGGATTTGTCTCATTTTATAATGACGTGGATGTGC
AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAACTGGGCCCTGCAATCAGGAAACA
AAATTTATGTACTTATCATGTGCAGCCACGTCCTTTGATTTTTAATCCTCCTCCTCCACCACAGTTCCAG
AGTGTTTGGAGTAGTCCAAATGCTGAGACTTACATGCAGCCTCCAACCATGATGAATCCTATCACTCAGT
ATGTTCAGGCATATCCTCCTTATCCAAGTTCACCAGTTCGGGTCATCACTGGATATCAGCTGCCTGTTTA
TAACTACCAGATGCCACCGCAGTGGCCTGCTGGAGAGCAGAGGAGTTATGTTATACCTCCGGCTTATACA
ACTGTTAACTACCACTGCAGTGAAGTTGATCCAGGAGCTGATATTTTGCCCAATGAATGTTCAGTTCATG
ATGCTGCTCCAGCTTCTGGAAATGGCCCGCAAAAGAAGTCTGTGGACCGAAGCATACAGACAGTGGTCTC
TTGTCTGTTTAACCCTGAGAACAGGCTGAGAAACTCTCTTGTTACTCAAGATGACTACTTCAAGGATAAA
AGAGTACATCACTTCAGAAGAAGTCGGGCAGTGCTTAAATCTGATCATCTCTGCTAA


Restriction Sites SgfI-MluI     
ACCN NM_010021
ORF Size 897 bp
Insert Size 897
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq BC099940, AAH99940
RefSeq Size 2936
RefSeq ORF 897
Locus ID 13164
Gene Summary This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Transcript Variant: This variant (1, also known as Dazl_FL) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.