Defa1 (NM_010031) Mouse Untagged Clone

CAT#: MC208374

Defa1 (untagged) - Mouse defensin, alpha 1 (Defa1), (10ug)


  "NM_010031" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "Defa1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Defa1
Synonyms Defcr; Defcr1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208374 representing NM_010031
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGAAACTAGTCCTACTCTTTGCCCTTGTCCTGCTTGGCTTCCAGGTCCAGGCTGATTCTATCCAAA
ACACAGATGAAGAGACTAAAACTGAGGAGCAGCCAGGAGAAGAGGACCAGGCCGTATCTGTCTCCTTTGG
AGACCCAGAAGGCACTTCTCTTCAAGAGGAATCGTTGAGAGATCTGGTATGCTATTGTAGATCAAGAGGC
TGCAAAGGAAGAGAACGCATGAATGGAACCTGCAGAAAGGGTCATTTATTGTACACGCTCTGCTGTCGCT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010031
ORF Size 282 bp
Insert Size 282
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_010031.2, NP_034161.2
RefSeq Size 427
RefSeq ORF 282
Locus ID 13216
Gene Summary Probably contributes to the antimicrobial barrier function of the small bowel mucosa. Has antibacterial activity against attenuated mutants of S.typhimurium. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.