Egr3 (NM_018781) Mouse Untagged Clone

CAT#: MC208426

Egr3 (untagged) - Mouse early growth response 3 (Egr3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Egr3
• Synonyms: Pilot
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC208426 representing NM_018781
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_018781
• ORF Size: 1164 bp
• Insert Size: 1164
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_018781.2, NP_061251.1
• RefSeq Size: 1416
• RefSeq ORF: 1164
• Locus ID: 13655
• Gene Summary: Probable transcription factor involved in muscle spindle development. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.